JASPAR Database

SkillDev tools

Query JASPAR for transcription factor binding site (TFBS) profiles (PWMs/PFMs), searching by TF name, species, or class, scanning DNA sequences for binding sites, and comparing matrices. Use when doing motif analysis, regulatory genomics, transcription factor binding prediction, or interpreting regulatory/non-coding GWAS variants. Part of the AlterLab Academic Skills suite.

Available today. Use it from your connected AI after setup.

Connect ahel once, and every AI you use reads what you have installed.

Then ask your AI: use the JASPAR Database skill

What this skill tells your AI

The instructions your AI receives, as published by alterlab-ieu/alterlab-academic-skills in skills/databases/alterlab-jaspar/SKILL.md and read by ahel’s review.

Overview

JASPAR (https://jaspar.elixir.no/) is the gold-standard open-access database of curated, non-redundant transcription factor (TF) binding profiles stored as position frequency matrices (PFMs). The JASPAR 2024 release added 329 new profiles to the CORE collection (~20% growth over the prior release); the live API currently serves ~2,600 latest-version CORE profiles across taxa. Each profile is experimentally derived (ChIP-seq, SELEX, HT-SELEX, protein binding microarray, etc.) and curated.

Key resources:

Scripts

scripts/query_jaspar.py — query the JASPAR REST API (stdlib only, JSON to stdout):

python scripts/query_jaspar.py search --name CTCF --species 9606   # latest-version profiles only
python scripts/query_jaspar.py search --name CTCF --all-versions   # include historical versions
python scripts/query_jaspar.py matrix MA0139.1                     # fetch a matrix (PFM)

search defaults to version=latest (one row per profile); pass --all-versions to see every historical version. --species maps to the API's tax_id param (NCBI taxonomy ID).

When to Use This Skill

Use JASPAR when:

  • TF binding site prediction: Scan a DNA sequence for potential binding sites of a TF
  • Regulatory variant interpretation: Does a GWAS/eQTL variant disrupt a TF binding motif?
  • Promoter/enhancer analysis: What TFs are predicted to bind to a regulatory element?
  • Gene regulatory network construction: Link TFs to their target genes via motif scanning
  • TF family analysis: Compare binding profiles across a TF family (e.g., all homeobox factors)
  • ChIP-seq analysis: Find known TF motifs enriched in ChIP-seq peaks
  • ENCODE/ATAC-seq interpretation: Match open chromatin regions to TF binding profiles

Core Capabilities

1. JASPAR REST API

Base URL: https://jaspar.elixir.no/api/v1/

import requests

BASE_URL = "https://jaspar.elixir.no/api/v1"

def jaspar_get(endpoint, params=None):
    url = f"{BASE_URL}/{endpoint}"
    response = requests.get(url, params=params, headers={"Accept": "application/json"})
    response.raise_for_status()
    return response.json()

2. Search for TF Profiles

def search_jaspar(
    tf_name=None,
    species=None,
    collection="CORE",
    tf_class=None,
    tf_family=None,
    page=1,
    page_size=25
):
    """Search JASPAR for TF binding profiles."""
    params = {
        "collection": collection,
        "page": page,
        "page_size": page_size,
        "format": "json"
    }
    if tf_name:
        params["name"] = tf_name
    if species:
        params["tax_id"] = species  # NCBI taxonomy ID, e.g. "9606" for human
    if tf_class:
        params["tf_class"] = tf_class
    if tf_family:
        params["tf_family"] = tf_family

    return jaspar_get("matrix", params)

# Examples:
# Search for human CTCF profile
ctcf = search_jaspar("CTCF", species="9606")
print(f"Found {ctcf['count']} CTCF profiles")

# Search for all homeobox TFs in human
hox_tfs = search_jaspar(tf_class="Homeodomain", species="9606")

# Search for a TF family
nfkb = search_jaspar(tf_family="NF-kappaB")

3. Fetch a Specific Matrix (PFM/PWM)

def get_matrix(matrix_id):
    """Fetch a specific JASPAR matrix by ID (e.g., 'MA0139.1' for CTCF)."""
    return jaspar_get(f"matrix/{matrix_id}/")

# Example: Get CTCF matrix
ctcf_matrix = get_matrix("MA0139.1")

# Matrix structure (actual API fields; no "consensus" or "length" key — derive
# motif length from len(pfm["A"])):
# {
#   "matrix_id": "MA0139.1",
#   "name": "CTCF",
#   "base_id": "MA0139",
#   "version": 1,
#   "collection": "CORE",
#   "tax_group": "vertebrates",
#   "pfm": { "A": [...], "C": [...], "G": [...], "T": [...] },  # 19 columns for CTCF
#   "species": [{"tax_id": 9606, "name": "Homo sapiens"}],
#   "class": ["C2H2 zinc finger factors"],
#   "family": ["More than 3 adjacent zinc fingers"],
#   "type": "ChIP-seq",
#   "uniprot_ids": ["P49711"],
#   "pubmed_ids": ["17512414"],
#   "sequence_logo": "https://jaspar.elixir.no/static/logos/svg/MA0139.1.svg"
# }

4. Download PFM/PWM as Matrix

import numpy as np

def get_pwm(matrix_id, pseudocount=0.8):
    """
    Fetch a PFM from JASPAR and convert to PWM (log-odds).
    Returns numpy array of shape (4, L) in order A, C, G, T.
    """
    matrix = get_matrix(matrix_id)
    pfm = matrix["pfm"]

    # Convert PFM to numpy
    pfm_array = np.array([pfm["A"], pfm["C"], pfm["G"], pfm["T"]], dtype=float)

    # Add pseudocount
    pfm_array += pseudocount

    # Normalize to get PPM
    ppm = pfm_array / pfm_array.sum(axis=0, keepdims=True)

    # Convert to PWM (log-odds relative to background 0.25)
    background = 0.25
    pwm = np.log2(ppm / background)

    return pwm, matrix["name"]

# Example
pwm, name = get_pwm("MA0139.1")  # CTCF
print(f"PWM for {name}: shape {pwm.shape}")
max_score = pwm.max(axis=0).sum()
print(f"Maximum possible score: {max_score:.2f} bits")

5. Scan a DNA Sequence for TF Binding Sites

import numpy as np
from typing import List, Tuple

NUCLEOTIDE_MAP = {'A': 0, 'C': 1, 'G': 2, 'T': 3,
                  'a': 0, 'c': 1, 'g': 2, 't': 3}

def scan_sequence(sequence: str, pwm: np.ndarray, threshold_pct: float = 0.8) -> List[dict]:
    """
    Scan a DNA sequence for TF binding sites using a PWM.

    Args:
        sequence: DNA sequence string
        pwm: PWM array (4 x L) in ACGT order
        threshold_pct: Fraction of max score to use as threshold (0-1)

    Returns:
        List of hits with position, score, and matched sequence
    """
    motif_len = pwm.shape[1]
    max_score = pwm.max(axis=0).sum()
    min_score = pwm.min(axis=0).sum()
    threshold = min_score + threshold_pct * (max_score - min_score)

    hits = []
    seq = sequence.upper()

    for i in range(len(seq) - motif_len + 1):
        subseq = seq[i:i + motif_len]
        # Skip if contains non-ACGT
        if any(c not in NUCLEOTIDE_MAP for c in subseq):
            continue

        score = sum(pwm[NUCLEOTIDE_MAP[c], j] for j, c in enumerate(subseq))

        if score >= threshold:
            relative_score = (score - min_score) / (max_score - min_score)
            hits.append({
                "position": i + 1,  # 1-based
                "score": score,
                "relative_score": relative_score,
                "sequence": subseq,
                "strand": "+"
            })

    return hits

# Example: Scan a promoter sequence for CTCF binding sites
# (windows containing non-ACGT bases such as N are skipped by scan_sequence)
promoter = "AGCCCGCGAGGTGGCAGTTGCCTGGAGCAGGATCAGCAGATC"
pwm, name = get_pwm("MA0139.1")
hits = scan_sequence(promoter, pwm, threshold_pct=0.75)
for hit in hits:
    print(f"  Position {hit['position']}: {hit['sequence']} (score: {hit['score']:.2f}, {hit['relative_score']:.0%})")

6. Scan Both Strands

def reverse_complement(seq: str) -> str:
    complement = {'A': 'T', 'T': 'A', 'C': 'G', 'G': 'C', 'N': 'N'}
    return ''.join(complement.get(b, 'N') for b in reversed(seq.upper()))

def scan_both_strands(sequence: str, pwm: np.ndarray, threshold_pct: float = 0.8):
    """Scan forward and reverse complement strands."""
    fwd_hits = scan_sequence(sequence, pwm, threshold_pct)
    for h in fwd_hits:
        h["strand"] = "+"

    rev_seq = reverse_complement(sequence)
    rev_hits = scan_sequence(rev_seq, pwm, threshold_pct)
    seq_len = len(sequence)
    for h in rev_hits:
        h["strand"] = "-"
        h["position"] = seq_len - h["position"] - len(h["sequence"]) + 2  # Convert to fwd coords

    all_hits = fwd_hits + rev_hits
    return sorted(all_hits, key=lambda x: x["position"])

7. Variant Impact on TF Binding

def variant_tfbs_impact(ref_seq: str, alt_seq: str, pwm: np.ndarray,
                          tf_name: str, threshold_pct: float = 0.7):
    """
    Assess impact of a SNP on TF binding by comparing ref vs alt sequences.
    Both sequences should be centered on the variant with flanking context.
    """
    ref_hits = scan_both_strands(ref_seq, pwm, threshold_pct)
    alt_hits = scan_both_strands(alt_seq, pwm, threshold_pct)

    max_ref = max((h["score"] for h in ref_hits), default=None)
    max_alt = max((h["score"] for h in alt_hits), default=None)

    result = {
        "tf": tf_name,
        "ref_max_score": max_ref,
        "alt_max_score": max_alt,
        "ref_has_site": len(ref_hits) > 0,
        "alt_has_site": len(alt_hits) > 0,
    }
    if max_ref and max_alt:
        result["score_change"] = max_alt - max_ref
        result["effect"] = "gained" if max_alt > max_ref else "disrupted"
    elif max_ref and not max_alt:
        result["effect"] = "disrupted"
    elif not max_ref and max_alt:
        result["effect"] = "gained"
    else:
        result["effect"] = "no_site"

    return result

Query Workflows

Workflow 1: Find All TF Binding Sites in a Promoter

import requests, numpy as np

# 1. Get relevant TF matrices (e.g., all human TFs in CORE collection)
response = requests.get(
    "https://jaspar.elixir.no/api/v1/matrix/",
    params={"species": "9606", "collection": "CORE", "page_size": 500, "page": 1}
)
matrices = response.json()["results"]

# 2. For each matrix, compute PWM and scan promoter
promoter = "CCCGCCCGCCCGCCGCCCGCAGTTAATGAGCCCAGCGTGCC"  # Example

all_hits = []
for m in matrices[:10]:  # Limit for demo
    matrix_data = requests.get(f"https://jaspar.elixir.no/api/v1/matrix/{m['matrix_id']}/").json()
    pfm = matrix_data["pfm"]
    pfm_arr = np.array([pfm["A"], pfm["C"], pfm["G"], pfm["T"]], dtype=float) + 0.8
    ppm = pfm_arr / pfm_arr.sum(axis=0)
    pwm = np.log2(ppm / 0.25)

    hits = scan_sequence(promoter, pwm, threshold_pct=0.8)
    for h in hits:
        h["tf_name"] = m["name"]
        h["matrix_id"] = m["matrix_id"]
    all_hits.extend(hits)

print(f"Found {len(all_hits)} TF binding sites")
for h in sorted(all_hits, key=lambda x: -x["score"])[:5]:
    print(f"  {h['tf_name']} ({h['matrix_id']}): pos {h['position']}, score {h['score']:.2f}")

Workflow 2: SNP Impact on TF Binding (Regulatory Variant Analysis)

  1. Retrieve the genomic sequence flanking the SNP (±20 bp each side)
  2. Construct ref and alt sequences
  3. Scan with all relevant TF PWMs
  4. Report TFs whose binding is created or destroyed by the SNP

Workflow 3: Motif Enrichment Analysis

  1. Identify a set of peak sequences (e.g., from ChIP-seq or ATAC-seq)
  2. Scan all peaks with JASPAR PWMs
  3. Compare hit rates in peaks vs. background sequences
  4. Report significantly enriched motifs (Fisher's exact test or FIMO-style scoring)

Collections Available

The current JASPAR API serves two collections (verify counts via GET /matrix/?collection=...&version=latest):

CollectionDescriptionLatest-version profiles (approx.)
CORENon-redundant, curated, experimentally validated profiles~2,600
UNVALIDATEDInferred/experimentally derived but not yet validated~1,400

Legacy collections (PHYLOFACTS, CNE, POLII, FAM, SPLICE) appear in older JASPAR literature but return 0 results from the current API — do not rely on them.

Best Practices

  • Use CORE collection for most analyses — best validated and non-redundant
  • Threshold selection: 80% of max score is common for de novo prediction; 90% for high-confidence
  • Always scan both strands — TFs can bind in either orientation
  • Provide flanking context for variant analysis: at least (motif_length - 1) bp on each side
  • Consider background: PWM scores relative to uniform (0.25) background; adjust for actual GC content
  • Cross-validate with ChIP-seq data when available — motif scanning has many false positives
  • Use Biopython's motifs module for full-featured scanning: from Bio import motifs

Additional Resources

Signals

GitHub stars
67
Forks
13
Last commit
Sep 2026
Advanced
Catalog kind
skill
Gateway key
alterlab-jaspar
Source
github.com/alterlab-ieu/alterlab-academic-skills