bio-clip-seq-clip-preprocessing

SkillDev tools

Lets your agent preprocess biomedical images and sequence data for AI analysis.

Available today. Use it from your connected AI after setup.

Connect ahel once, and every AI you use reads what you have installed.

Then ask your AI: use the bio-clip-seq-clip-preprocessing skill

About this capability

The largest open-source medical AI skills library for OpenClaw🦞.

What this skill tells your AI

The instructions your AI receives, as published by freedomintelligence/openclaw-medical-skills in skills/bio-clip-seq-clip-preprocessing/SKILL.md and read by ahel’s review.


name: bio-clip-seq-clip-preprocessing description: Preprocess CLIP-seq data including adapter trimming, UMI extraction, and PCR duplicate removal. Use when preparing raw CLIP, iCLIP, or eCLIP reads for peak calling. tool_type: cli primary_tool: umi_tools measurable_outcome: Execute skill workflow successfully with valid output within 15 minutes. allowed-tools:

  • read_file
  • run_shell_command

CLIP-seq Preprocessing

UMI Extraction (eCLIP/iCLIP)

# Extract UMI from read 1
umi_tools extract \
    --stdin=reads_R1.fastq.gz \
    --read2-in=reads_R2.fastq.gz \
    --bc-pattern=NNNNNNNNNN \
    --stdout=R1_umi.fastq.gz \
    --read2-out=R2_umi.fastq.gz

# bc-pattern: UMI barcode pattern
# N = UMI base
# For eCLIP: typically 10-nt UMI in read 1

Adapter Trimming

# Trim adapters after UMI extraction
cutadapt \
    -a AGATCGGAAGAGCACACGTCT \
    -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT \
    -m 18 \
    -o trimmed_R1.fastq.gz \
    -p trimmed_R2.fastq.gz \
    R1_umi.fastq.gz R2_umi.fastq.gz

Two-Pass Trimming (eCLIP)

# eCLIP protocol has inline adapters
# First pass: trim 3' adapter
cutadapt -a AGATCGGAAGAGC -m 18 -o pass1.fq.gz input.fq.gz

# Second pass: trim 5' adapter (read-through)
cutadapt -g AGATCGGAAGAGC -m 18 -o pass2.fq.gz pass1.fq.gz

PCR Duplicate Removal

# After alignment, deduplicate using UMIs
umi_tools dedup \
    --stdin=aligned.bam \
    --stdout=deduped.bam \
    --paired \
    --method=unique

# Methods:
# unique: Exact UMI match
# cluster: Allow UMI mismatches (default)
# adjacency: Network-based clustering

Python Preprocessing

from umi_tools import UMIClusterer
import pysam

def count_umis_per_position(bam_path):
    '''Count unique UMIs at each genomic position'''
    from collections import defaultdict

    position_umis = defaultdict(set)

    with pysam.AlignmentFile(bam_path, 'rb') as bam:
        for read in bam:
            if read.is_unmapped:
                continue

            # Extract UMI from read name (added by umi_tools extract)
            umi = read.query_name.split('_')[-1]
            pos = (read.reference_name, read.reference_start)
            position_umis[pos].add(umi)

    return {pos: len(umis) for pos, umis in position_umis.items()}

Quality Control

def clip_qc(bam_path):
    '''CLIP-seq specific QC metrics'''
    import pysam

    total = 0
    unique_positions = set()
    read_lengths = []

    with pysam.AlignmentFile(bam_path, 'rb') as bam:
        for read in bam:
            if read.is_unmapped:
                continue
            total += 1
            unique_positions.add((read.reference_name, read.reference_start))
            read_lengths.append(read.query_length)

    return {
        'total_reads': total,
        'unique_positions': len(unique_positions),
        'mean_read_length': sum(read_lengths) / len(read_lengths),
        'complexity': len(unique_positions) / total
    }

Related Skills

  • clip-alignment - Align preprocessed reads
  • read-qc/umi-processing - General UMI handling
  • clip-peak-calling - Call peaks from aligned reads

Signals

GitHub stars
3k
Forks
408
Last commit
Jul 2026
Advanced
Catalog kind
skill
Gateway key
bio-clip-seq-clip-preprocessing
Source
github.com/freedomintelligence/openclaw-medical-skills